View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14295_low_56 (Length: 207)
Name: NF14295_low_56
Description: NF14295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14295_low_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 12 - 190
Target Start/End: Original strand, 41785732 - 41785910
Alignment:
| Q |
12 |
gaggagcacagagagtgtgtcatgagcaatgtgtctaaaatgctttgtgaggttcagtttgcgaaggattggataaagaaaatgaacgtcgaaatgaaac |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41785732 |
gaggaacacagagagtgtgtcatgagcaatgtgtctaaaatgctttgtgaggttcagtttgcgaaggattggataaagaaaatgaacgtcgaaatgaaac |
41785831 |
T |
 |
| Q |
112 |
aattgaaggaaaatgtggattgtcttacaacgctactgagcgaaaaagaagagcaggaattgttgttaagagacaaagt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41785832 |
aattgaaggaaaatgtggattgtcttacaacgctactgagcgaaaaagaagagcaggaattgttgttaagagacaaagt |
41785910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 97
Target Start/End: Original strand, 10835111 - 10835178
Alignment:
| Q |
26 |
gtgtgtcatgagcaatgtgtctaaaatgctttgtgaggttcagtttgcgaaggattggataaagaaaatgaa |
97 |
Q |
| |
|
|||||||||||||| ||| |||||||| || ||||||| |||||| |||||| |||||||||||||||| |
|
|
| T |
10835111 |
gtgtgtcatgagcagtgtttctaaaattct----gaggttcggtttgctaaggataggataaagaaaatgaa |
10835178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University