View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14295_low_6 (Length: 529)
Name: NF14295_low_6
Description: NF14295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14295_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 2e-50; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 190 - 291
Target Start/End: Complemental strand, 107155 - 107054
Alignment:
| Q |
190 |
gagagcttacagtggagaaaatgttgatccatcaagcaagagcagcagcagtagcgaggagaaaggagaatgaaaaccctaattcagagaatggaacaac |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
107155 |
gagagcttacagtggagaaaatgttgatccatcaagcaagagcagcagcagtagcgaggagaaaggagaatgaaaaccctaattcagagaatggaacaac |
107056 |
T |
|
| Q |
290 |
ga |
291 |
Q |
| |
|
|| |
|
|
| T |
107055 |
ga |
107054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 18 - 108
Target Start/End: Complemental strand, 107335 - 107245
Alignment:
| Q |
18 |
gaatctaatcttaatagatgatgatgattatagaatagaagaggaaatgcgagtaaataacacgtttgattagggtaggggaaatcgatag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
107335 |
gaatctaatcttaatagatgatgatgattatagaatagaagaggaaatgcgagtaaataacacgtttgattagggtaggggaaatcgatag |
107245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 379 - 465
Target Start/End: Complemental strand, 106966 - 106880
Alignment:
| Q |
379 |
gtgggactttgttggtgacagcctgtctccagctgtattctccgaaccttccgcttcgtcctcaaacccacttgcttcggtcatcta |
465 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
106966 |
gtgggactttgttggtgacagcctgtctccagctgtattctccgaaccttccgcttcgtcctcaaacccacttgcttcggtcatcta |
106880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University