View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14296_high_12 (Length: 329)
Name: NF14296_high_12
Description: NF14296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14296_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 163 - 299
Target Start/End: Original strand, 11816813 - 11816949
Alignment:
| Q |
163 |
aaaatttaattcatttaattactttcgattacattttaacttcatctaattattggtttagtttgacgactatcttctcatatagaaatttaaacagtta |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||| |
|
|
| T |
11816813 |
aaaatttaattcatttaattactttcgattacattttaattttatctaattattggtttagtttgatgactatcttctcatacagaaatttaaacggtta |
11816912 |
T |
 |
| Q |
263 |
tcatgccaaacgcaacgattaatgcaagatagaaatg |
299 |
Q |
| |
|
||||| ||||||||| || |||| || ||||||||| |
|
|
| T |
11816913 |
tcatggcaaacgcaaaaatcaatgtaatatagaaatg |
11816949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 53 - 171
Target Start/End: Original strand, 11815741 - 11815859
Alignment:
| Q |
53 |
ctgcttttgttataaaatttgtttcaaatgttatgaaatta--actcgaagtaatttatgttgtatttatttgatttgatttcaatttagactctaatta |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11815741 |
ctgcttttgttataaaatttgtttcaaatgttatg-aattagtactcgaactaatttatgttgtatttatttgatttga-ttcaatttagactctaatta |
11815838 |
T |
 |
| Q |
151 |
gaaacaacaccaaaaatttaa |
171 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
11815839 |
gatacaacaccaaaaatttaa |
11815859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University