View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14296_high_14 (Length: 249)
Name: NF14296_high_14
Description: NF14296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14296_high_14 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 144 - 249
Target Start/End: Complemental strand, 54798656 - 54798551
Alignment:
| Q |
144 |
tagcaccatgtgacaaaaccacatgttcaatgtatgacttgccattaatttaatgaagttttcaggtaaaagtagtcacagaaattaacatggcatatgc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54798656 |
tagcaccatgtgacaaaaccacatgttcaatgtatgacttgccattaatttaatgaggttttcaggtaaaagtagtcacagaaattaacatggcatatgc |
54798557 |
T |
|
| Q |
244 |
aaacca |
249 |
Q |
| |
|
|||||| |
|
|
| T |
54798556 |
aaacca |
54798551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 95 - 126
Target Start/End: Complemental strand, 54798705 - 54798674
Alignment:
| Q |
95 |
tctaatcatgttcaatgtatgtatgaccttgt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
54798705 |
tctaatcatgttcaatgtatgtatgaccttgt |
54798674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University