View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14296_low_14 (Length: 293)
Name: NF14296_low_14
Description: NF14296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14296_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 8 - 276
Target Start/End: Original strand, 5789806 - 5790073
Alignment:
| Q |
8 |
ccaataatattggatacccatcaatagnnnnnnnnngtttaatatgcacaaacaagtcagtcttgaccataaacnnnnnnnnn--tcgttattagatcaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || ||| ||||||||||| |
|
|
| T |
5789806 |
ccaataatattggatacccatcaatagttttttt--gtttaatatgcacaaacaagtcagtcttgaccatatacaaaaaaaaaaatcgctattagatcaa |
5789903 |
T |
|
| Q |
106 |
taaatctcatcatatcttatttgattcaattgtaagactaattaatcaaatgattnnnnnnn-caaatttgtacataatacaagacttattatctcactt |
204 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |||| ||||| |||||||||||||||| ||||||| |
|
|
| T |
5789904 |
taaatctcatcatatcttattttattcaattgtaagactaattgatcaaatgattaaaaaaaacaaaattgtatataatacaagacttat---ctcactt |
5790000 |
T |
|
| Q |
205 |
ctgcgcattataaagttgtccccgtgaaa-cataagtataaaattgcaatgattcaatcaagaagtcctagct |
276 |
Q |
| |
|
||||||| |||||| ||| ||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5790001 |
ctgcgcactataaaattgcccctctgaaagcataagtataaaattgcaatgattcaatcaagaagtcctagct |
5790073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 96 - 135
Target Start/End: Complemental strand, 21135952 - 21135913
Alignment:
| Q |
96 |
attagatcaataaatctcatcatatcttatttgattcaat |
135 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
21135952 |
attagattaataaatctcatcatatcttatttgatccaat |
21135913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 100 - 136
Target Start/End: Complemental strand, 50891299 - 50891263
Alignment:
| Q |
100 |
gatcaataaatctcatcatatcttatttgattcaatt |
136 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
50891299 |
gatcaaaaaatctcatcatatctcatttgattcaatt |
50891263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University