View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14296_low_21 (Length: 212)
Name: NF14296_low_21
Description: NF14296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14296_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 9282308 - 9282489
Alignment:
| Q |
19 |
attggatgtcttcgcaaaagttgttgatgcataaaaattatgttggtataggtttcacggaccttactattttcaatttggcaacgctaggcaacaaggc |
118 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9282308 |
attggatgtcttcggaaaagttgtcgatgcataaaaattatgttggtataggtttcacggaccttactactttcaatttggcaacgctaggcaacaaggc |
9282407 |
T |
|
| Q |
119 |
ttaaagtttcaaaccgatccaaattctttggtttcctggttatttaatttaaagctcggtagttccccacttagaattatct |
200 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9282408 |
ataaagattcaaactgatccaaattctttggtttcctggttatttaatttaaagctcggtagttccccacttagagttatct |
9282489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 75
Target Start/End: Original strand, 9927512 - 9927569
Alignment:
| Q |
18 |
aattggatgtcttcgcaaaagttgttgatgcataaaaattatgttggtataggtttca |
75 |
Q |
| |
|
|||||||| |||| | ||||||||| |||||||||||| |||| |||||| ||||||| |
|
|
| T |
9927512 |
aattggatttcttgggaaaagttgtcgatgcataaaaaatatggtggtatgggtttca |
9927569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University