View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14296_low_22 (Length: 208)
Name: NF14296_low_22
Description: NF14296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14296_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 19 - 194
Target Start/End: Original strand, 42617778 - 42617953
Alignment:
| Q |
19 |
gaactcctactatcttttgtaaaatgtttaagagaatttatgaaaatatatagcttatatacgactaactttcgacttaattttatgaacnnnnnnnnnc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42617778 |
gaactcctactatcttttgtaaaatgtttaaaagaatttatgaaaatatatagcttatatacgactaactttcgacttaattttatgaactttttttttc |
42617877 |
T |
 |
| Q |
119 |
gaggggcaacttttgttaatatagcttacttttaaaaagaatagtttaaccacatcttctctttaatagtaaaaat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42617878 |
gaggggcaacttttgttaatatagcttacttttaaaaagaatagtttaaccacatgttctctttaatagtaaaaat |
42617953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University