View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14297_high_30 (Length: 294)

Name: NF14297_high_30
Description: NF14297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14297_high_30
NF14297_high_30
[»] chr3 (2 HSPs)
chr3 (19-66)||(15297793-15297840)
chr3 (147-202)||(15298106-15298160)


Alignment Details
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 15297793 - 15297840
Alignment:
19 aggcaactaaacccaacatgtttatgtaattctcagttaattacgtat 66  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||    
15297793 aggcaacaaaacccaacatgtttatgtaattctcagttaattacgtat 15297840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 147 - 202
Target Start/End: Original strand, 15298106 - 15298160
Alignment:
147 actttagtatatagaatatgacaagtgaaaaattcgaagtcaaatgatgacttaaa 202  Q
    ||||||||| || |||||| ||||||||||||||| ||||||||||||||||||||    
15298106 actttagtacat-gaatatcacaagtgaaaaattcaaagtcaaatgatgacttaaa 15298160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University