View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14297_high_38 (Length: 251)
Name: NF14297_high_38
Description: NF14297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14297_high_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 19 - 213
Target Start/End: Original strand, 4917924 - 4918120
Alignment:
| Q |
19 |
gagagagttgataacatttctctcttnnnnnnnn-caaatatttaatatctaaaattgattatttgcaagacaattcaaccccatctaataaaataaaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4917924 |
gagagagttgataacatttctctcttactaaaaaacaaatatttaatatctaaagttgattatttgcaagacaattcaaccccatctaataaaataaaac |
4918023 |
T |
 |
| Q |
118 |
aaaaatctgctgaggtcttaaaggtcagtctcataatgagccaaaatttcgaagttgtggtgtggaaatacctta-gttgtcggttgagagttaata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4918024 |
aaaaatctgctgaggtcttaaaggtcagactcataatgagccaaaatttcgaagttgtggtgtggaaataccttaggttgtcggttgagagttaata |
4918120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University