View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14297_high_40 (Length: 239)
Name: NF14297_high_40
Description: NF14297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14297_high_40 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 9468618 - 9468396
Alignment:
| Q |
1 |
aatttgtaaactttgttttcctgataaaatgacaagatctcaaatttaggtgtgctgcctattattatagctatgatttctaacttttgatacttattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9468618 |
aatttgtaaactttgttttcctgataaaatgacaagatctcaaatttaggtgtgctgcctattattatagctatgatttctaacttttgatatttattgg |
9468519 |
T |
 |
| Q |
101 |
gaactttatagcactatttacaaagtatactagaaaactgaaattagtgacaataatttaggtaggagcgttgtaaaatttgcaactcaaattttagatg |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||| |||||||||| |||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
9468518 |
gaactttataacactatttacaaagtatactagaaaactaaaattagtgagaataatttagagaggagcgttggaaaatatgcaactcaaattttagatg |
9468419 |
T |
 |
| Q |
201 |
tcaagtgtctatgaggttcagtt |
223 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
9468418 |
tcaagtgtctataaggttcagtt |
9468396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University