View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14297_low_31 (Length: 294)
Name: NF14297_low_31
Description: NF14297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14297_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 15297793 - 15297840
Alignment:
| Q |
19 |
aggcaactaaacccaacatgtttatgtaattctcagttaattacgtat |
66 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15297793 |
aggcaacaaaacccaacatgtttatgtaattctcagttaattacgtat |
15297840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 147 - 202
Target Start/End: Original strand, 15298106 - 15298160
Alignment:
| Q |
147 |
actttagtatatagaatatgacaagtgaaaaattcgaagtcaaatgatgacttaaa |
202 |
Q |
| |
|
||||||||| || |||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15298106 |
actttagtacat-gaatatcacaagtgaaaaattcaaagtcaaatgatgacttaaa |
15298160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University