View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14297_low_34 (Length: 276)
Name: NF14297_low_34
Description: NF14297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14297_low_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 261
Target Start/End: Complemental strand, 2314274 - 2314025
Alignment:
| Q |
20 |
atggacaaattataatagtatactagtcttgttttagtaaatttcgaagcatacataatacac-------ataaaaaattaatcaaacaatcaagttttt |
112 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||| |||| |||||||||||||||||||| ||| |
|
|
| T |
2314274 |
atggacaaattataatagttgactaggcttgttttagtaaatttcgaagcatagataatacactatacacataacaaattaatcaaacaatcaagccttt |
2314175 |
T |
 |
| Q |
113 |
ataaatccttactataatgataaagataatat-aaaaaatcaaatactaaaaagcacttcgaattatccaaatggtatacaacactttaaacattttggt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
2314174 |
ataaatccttactataatgataaagataattttaaaaaatcaaatagtaaaatgcacttcgaattaaccaaatggtatacaacactttaaacattttagt |
2314075 |
T |
 |
| Q |
212 |
ttattgagaatattaattggtttcatgaggaattttcatggctgattggt |
261 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2314074 |
ttggtgagaatattaattggtttcatgaggaattttcatggctgattggt |
2314025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University