View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14297_low_40 (Length: 244)
Name: NF14297_low_40
Description: NF14297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14297_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 9 - 231
Target Start/End: Complemental strand, 12104697 - 12104475
Alignment:
| Q |
9 |
aggaggagcacagagctggagagttccttccatttggagtaggaactagattgtgccctggaaatgatcttgctaagctggaaatctcagttttccttca |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12104697 |
aggaggtgcacagagctggagagttccttccatttggagtaggaactagattgtgccctggaaatgatcttgctaagctggaaatctcagttttccttca |
12104598 |
T |
 |
| Q |
109 |
ccactttctcctcaactatgagtaaatatttttctccctctttttactactcacatgaannnnnnnctcacacacaatatattattgaagcaaagtatac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12104597 |
ccactttctcctcaactatgagtaaatatttttctccctctttttactactcacatgaatttttttctcacacacaatatattattgaagcaaagtatac |
12104498 |
T |
 |
| Q |
209 |
atcattccaatattaaaattgat |
231 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12104497 |
atcattccaatattaaaattgat |
12104475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 108
Target Start/End: Complemental strand, 12113437 - 12113361
Alignment:
| Q |
32 |
ttccttccatttggagtaggaactagattgtgccctggaaatgatcttgctaagctggaaatctcagttttccttca |
108 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||| ||||| ||||||||||| || ||||||| ||||||| ||||| |
|
|
| T |
12113437 |
ttccttccctttggagcaggaactagattgtgtcctggcaatgatcttgccaaaatggaaatagcagtttttcttca |
12113361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University