View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14297_low_41 (Length: 239)
Name: NF14297_low_41
Description: NF14297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14297_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 30880636 - 30880511
Alignment:
| Q |
1 |
ttgctaatgcaacttctctggcttttgttgtaagaaacataaaaaatgaggttcacagctcaagaggaaagatcaccgaatttcatttgagtgactttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30880636 |
ttgctaatgcaacttctctggcttttgttgtaagaaacataaaaaatgaggttcacagctcaagaggaaagatcatcgaatttcatttgagtgactttga |
30880537 |
T |
|
| Q |
101 |
gtttgatgactttatctctatctctc |
126 |
Q |
| |
|
||||||||||||||||| |||||||| |
|
|
| T |
30880536 |
gtttgatgactttatctttatctctc |
30880511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 90 - 126
Target Start/End: Complemental strand, 7537094 - 7537058
Alignment:
| Q |
90 |
agtgactttgagtttgatgactttatctctatctctc |
126 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
7537094 |
agtgactttgagtttggtgactttgtctctatctctc |
7537058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University