View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14298_low_3 (Length: 272)
Name: NF14298_low_3
Description: NF14298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14298_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 20 - 260
Target Start/End: Original strand, 31693634 - 31693874
Alignment:
| Q |
20 |
gcttccacttttattgaatctttgacatgtttaaatattaccgagagtaattgattttgtctataaaattgatttcaccccgcactttttattgctgacg |
119 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31693634 |
gcttccacttttattgattctttgacatgtttaaatattaccgagagtaattgattttgtctataaaattgatttcaccccgcactttttattgctgacg |
31693733 |
T |
|
| Q |
120 |
aaggaatttcgatgactggaccttgccatatggcacttagttgccatgtcattaatgatcgagtgcaacgtgaccgcgatattaaaccttaagtttgtta |
219 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31693734 |
aaggaattttgatgactggaccttgccatatggcacttagttgccatgtcattaatgattgagtacaacgtgaccgcgatattaaaccttaagtttgtta |
31693833 |
T |
|
| Q |
220 |
atgattccattaagaaacatcggacaaatgattctctcctt |
260 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31693834 |
atgattccattaagaaacaccggacaaatgattctctcctt |
31693874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University