View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1429_high_55 (Length: 219)
Name: NF1429_high_55
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1429_high_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 17 - 205
Target Start/End: Original strand, 38717365 - 38717553
Alignment:
| Q |
17 |
aatggagatcgtgcttcaagatgagtcacctcatcgagtaaattcagtgtatgaagagttcaaaatcgaggtcactgctctgtttttggctgcacattct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38717365 |
aatggagatcgtgcttcaagatgagtcacctcatcgagtaaattcagtgtatgaagagttcaaaatcgaggtcactgctctgtttttggctgcacattct |
38717464 |
T |
 |
| Q |
117 |
ggaaatttgacattaattcgtaaactactggtatgcaactgttccgaatgttctgccttatattgtgtttacgaaaattatgttgcttg |
205 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
38717465 |
ggaaatttgacgttaattcgtaaactactggtatgcaaccgttccgaatgttctgccttatattgtgttttcgaaaattatgttccttg |
38717553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University