View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1429_low_29 (Length: 341)
Name: NF1429_low_29
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1429_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 1414954 - 1415175
Alignment:
| Q |
18 |
gatgatacaatgaatgaatcaaacttttgtgaattcttgatcaggtgagaactctagatcccaaagctgtgagtgatgagaattgcactggaaatactag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1414954 |
gatgatacaatgaatgaatcaaacttttgtgaatttttgatcaggtgagaactctagatcccaaagctgtgagtgatgagaattgcactggaaatactag |
1415053 |
T |
 |
| Q |
118 |
tgatggcaacaacacatggtagctccaaaagttaattgccaatttcaatgnnnnnnncttctctctttcttataagtgcatgcacgtaatggacttcata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1415054 |
tgatggcaacaacacatggtagctccaaaagttaattgccaatttcaatgtttttt--ttctctctttcttataagtgcatgcacgtaatagacttcata |
1415151 |
T |
 |
| Q |
218 |
tatatttaactcaaacaaatcatg |
241 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
1415152 |
tatatttcactcaaacaaatcatg |
1415175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 309 - 341
Target Start/End: Original strand, 1415243 - 1415275
Alignment:
| Q |
309 |
aagactcgtataatatattaattaataatgtct |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1415243 |
aagactcgtataatatattaattaataatgtct |
1415275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University