View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1429_low_39 (Length: 274)
Name: NF1429_low_39
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1429_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 16 - 268
Target Start/End: Original strand, 44266655 - 44266907
Alignment:
| Q |
16 |
ataggaccacatatgatgattcagaccaaattgttcatatccttaggatgcagcattgataaacaaaaacaaaatctgtaacaacttcaaacttgtgaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44266655 |
ataggaccacatatgatgattcagaccaaattgttcatatccttaggatgcagcattgataaacaaaaacaaaatctgtaacaacttcaaacttgtgaaa |
44266754 |
T |
 |
| Q |
116 |
ggaactagtttgttttctatatgtatattgtctattgcgtgaaggatttggtattgttgtatttaccatatcaaggaatccaatatggctgatnnnnnnn |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44266755 |
ggaactagtttgttttctatatgtatattgtctattgcgtgaaggatttggtattgttgtatttaccatatcaaggaatccaatatggctgataaaaaaa |
44266854 |
T |
 |
| Q |
216 |
ntaattgaagcttgtttggcttttccttaataatgccacacctacactatatt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44266855 |
ataattgaagcttgtttggcttttccttaataatgccacacctacactatatt |
44266907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University