View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1429_low_43 (Length: 267)
Name: NF1429_low_43
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1429_low_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 16 - 252
Target Start/End: Original strand, 28610927 - 28611160
Alignment:
| Q |
16 |
acaaatagtaatgaaactgcaaagaatgaacacagatagcagaatgctatttcttgataacttcggataaatttcagcagctttttgtgatcacttcatt |
115 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||| || |||||||||||| || ||||||||| |||||||||||||||||||||| |
|
|
| T |
28610927 |
acaaatagtaatgaaattgcaaagaatgaacatggatagcagaatgccatgtcttgataactttggtaaaatttcagtagctttttgtgatcacttcatt |
28611026 |
T |
 |
| Q |
116 |
caccgaatataaaatcccatgaaattttcttaaatttgaacataaagggcatattttgttcctaaattatattattttctccaagaaacgtgtcaaagac |
215 |
Q |
| |
|
|||||| ||||||||||||| |||||||| ||||||||||||||| ||| ||||||||| ||||| ||||||| ||| |||| ||| |||||||||||| |
|
|
| T |
28611027 |
caccga--ataaaatcccatg-aattttctaaaatttgaacataaatggcgtattttgttactaaactatattactttttccaggaaccgtgtcaaagac |
28611123 |
T |
 |
| Q |
216 |
aatgaattctataacatatggttgaattactgatatt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28611124 |
aatgaattctataacatatggttgaattcatgatatt |
28611160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University