View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1429_low_51 (Length: 237)
Name: NF1429_low_51
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1429_low_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 46138787 - 46138569
Alignment:
| Q |
1 |
taatcatgagtatctcaaggctattaagataagagggtttatattgtcccaaccgttttttggtgggaccaatagggtggcatcggagtcgaggctgtta |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46138787 |
taatcatgagtatctgaaggctattaagataagagggtttatattgtcccaaccgttttttggtgggaccaatagggtggcatcggagtcgaggctgtta |
46138688 |
T |
|
| Q |
101 |
aatgatcccgttttgccacctcatgtgtgtgacttgatgtgggaactagcgttgccggttggagttgaccgtgatcatgagtattgtaatccaacggttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46138687 |
aatgatcccgttttgccacctcatgtgtgtgacttgatgtgggaactagcgttgccggttggagttgaccgtgatcatgagtattgtaatccaacggttg |
46138588 |
T |
|
| Q |
201 |
gggattgtgttggagtttt |
219 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
46138587 |
gggattgcgttggagtttt |
46138569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 198
Target Start/End: Complemental strand, 46140542 - 46140505
Alignment:
| Q |
161 |
ggagttgaccgtgatcatgagtattgtaatccaacggt |
198 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
46140542 |
ggagttgatcgtgattatgagtattgtaatccaacggt |
46140505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 158 - 211
Target Start/End: Original strand, 22339267 - 22339320
Alignment:
| Q |
158 |
gttggagttgaccgtgatcatgagtattgtaatccaacggttggggattgtgtt |
211 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||| || ||| ||||| |
|
|
| T |
22339267 |
gttggagttaaccgtgattatgagtattgtaatccaacggtgggagatagtgtt |
22339320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 201
Target Start/End: Original strand, 22415984 - 22416026
Alignment:
| Q |
159 |
ttggagttgaccgtgatcatgagtattgtaatccaacggttgg |
201 |
Q |
| |
|
|||||||||| ||| ||||||||||||| |||||||||||||| |
|
|
| T |
22415984 |
ttggagttgatcgtaatcatgagtattgcaatccaacggttgg |
22416026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University