View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1429_low_53 (Length: 236)
Name: NF1429_low_53
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1429_low_53 |
 |  |
|
| [»] scaffold0170 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0170 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 122 - 221
Target Start/End: Complemental strand, 4308 - 4209
Alignment:
| Q |
122 |
ttgaaataggttggtaccgttcgcgttacctcatttttcctctgtctttatgccatatgtttagaaatgttgatcatatcttagcgtataagatgcttat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4308 |
ttgaaataggttggtaccgttcgcgttacttcatttttcctctgtctttatgccatatgtttagaaatgttgatcatatcttagcgtagaagatgcttat |
4209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0170; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 4446 - 4408
Alignment:
| Q |
1 |
tgaatttataggctaagatctttcattttgtgctcgttc |
39 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4446 |
tgaatttataggcgaagatctttcattttgtgctcgttc |
4408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University