View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1429_low_64 (Length: 203)
Name: NF1429_low_64
Description: NF1429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1429_low_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 13 - 184
Target Start/End: Complemental strand, 49207868 - 49207697
Alignment:
| Q |
13 |
cataggatgggagttaaaaattcaatggtgctatatagttgccttttaataaactatattgtggttgcagataggttttgaatgtttgtttctcaaaagc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49207868 |
cataggatgggagttaaaaattcaatggtgctatatagttgccttttaataaactatattgtggttgcagataggttttgaatgtttgtttctcaaaagc |
49207769 |
T |
|
| Q |
113 |
tagagacccccaatcgacagattaaacattacacaaagagaagtagcaaaatgctaattgaggccgcaaatc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49207768 |
tagagacccccaatcgacagattaaacattacacaaagagaagtagcaaaatgctaattgaggccgcaaatc |
49207697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 88 - 172
Target Start/End: Complemental strand, 49212475 - 49212392
Alignment:
| Q |
88 |
ttttgaatgtttgtttctcaaaagctagagacccccaatcgacagattaaacattacacaaagagaagtagcaaaatgctaattg |
172 |
Q |
| |
|
|||||| |||||||||||||||||| |||| |||||||| |||| ||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
49212475 |
ttttgattgtttgtttctcaaaagccagaggcccccaattgaca-attaaacattatacaaagagaagtatcaaaatgctaattg |
49212392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University