View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14300_high_29 (Length: 302)
Name: NF14300_high_29
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14300_high_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 152 - 280
Target Start/End: Original strand, 12198751 - 12198877
Alignment:
| Q |
152 |
tattttataattttatgttttatagtgttggttgtaaatccggaagtaagaaaaaacccataaacatcacatacaaacccgcatatatttaaaccgcata |
251 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| | |||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12198751 |
tattttataattttatgttttaaagtgttggttgtaaataccaaagtaagaaaaaactcataaacatcacatacaaacccgc--atatttaaaccgcata |
12198848 |
T |
 |
| Q |
252 |
acctacgattaagcaatccaccttatgtg |
280 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12198849 |
acctacgattaagcaatccaccttatgtg |
12198877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 12198603 - 12198670
Alignment:
| Q |
1 |
gttgagatatattcatatgagtgtctgctgtgttggtctatggttatttagattttagactattttgc |
68 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12198603 |
gttgagatatattcatatgagtgtctgatgtgttggtctatggttatttagattttagactattttgc |
12198670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University