View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14300_high_41 (Length: 244)

Name: NF14300_high_41
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14300_high_41
NF14300_high_41
[»] chr6 (1 HSPs)
chr6 (15-188)||(32815424-32815597)


Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 188
Target Start/End: Complemental strand, 32815597 - 32815424
Alignment:
15 cataggcataatctatagtatcaattgtgccacaaaataacaacttaaaccacgtatttttatgacaagttagttaaccacactagataacttaaactac 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
32815597 cataggcataatctatagtatcaattgtgccacaaaataacaacttaaaccacgtatttttatgacaagttagttaaccacactagatcacttaaactac 32815498  T
115 gaaatgtattttttaaagtgaatgatgacggtaacctttatgaccaatatatgatattatgaattgcaaagtat 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32815497 gaaatgtattttttaaagtgaatgatgacggtaacctttatgaccaatatatgatattatgaattgcaaagtat 32815424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University