View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14300_high_43 (Length: 238)
Name: NF14300_high_43
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14300_high_43 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 34490474 - 34490253
Alignment:
| Q |
17 |
atatttatctatttaattagtgttttaggacattagttagaatttttcttatgaaatttgttaaccaaagcctcgttaagcttcaaacaaagagaggaat |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34490474 |
atatttatctatttaattagtgtcttaggacattagttagaatttttcttatgaaatttgttaaccaaagcctcgttaagcttcaaacaaaga------t |
34490381 |
T |
 |
| Q |
117 |
ccgtgtag-taaggag-----acataaatcctcttgcctcaacccacgagtacgactgtttatcccgctactcattgtttctctttagagattagtgcaa |
210 |
Q |
| |
|
||| | | | ||| | ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34490380 |
tagtgcaacttacgaggtttcaaataaatcctcttgcctcaacccacgagtacgactgtttatccctctactcattgtttctctttagagattagtgcaa |
34490281 |
T |
 |
| Q |
211 |
cttattaatgattattttgttactgtat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34490280 |
cttattaatgattattttgttactgtat |
34490253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University