View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14300_high_45 (Length: 231)
Name: NF14300_high_45
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14300_high_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 2836026 - 2835832
Alignment:
| Q |
19 |
atctcagagattgacaaaagaaaacaaatgcatatcactcacaaaatgacatagtgaaccaagtaatagggctcaagtggttactgaactcccctaaggg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2836026 |
atctcagagattgacaaaagaaaacaaatgcatatcactcacaaaatgacatagtgaaccaagtaatagggctcaagtggttactgaactcccctaaggg |
2835927 |
T |
|
| Q |
119 |
caaatagctcgggagtacctaaattcgattcttaggtggaacatgttttttctaggatttacttacctaccggccgaactctggattttcagagt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
2835926 |
caaatagctcgggagtacctaaattcgattcttaggtggaacatgttttttctaggatttacttacctactggccgaactctggattatcagagt |
2835832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 204
Target Start/End: Complemental strand, 34199158 - 34199126
Alignment:
| Q |
172 |
aggatttacttacctaccggccgaactctggat |
204 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
34199158 |
aggatttacttacctcccggccgaactctggat |
34199126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University