View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14300_high_47 (Length: 225)
Name: NF14300_high_47
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14300_high_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 6291347 - 6291143
Alignment:
| Q |
1 |
gaaataagaggatttgtgtttggttccttagcttgccttaggagtattgtattttannnnnnncaattggtttggttttcttatatttatacatacataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6291347 |
gaaataagaggatttgtgtttggttccttagcttgccttaggagtattgtatttt--ttttttcaattggtttggttttcttatatttatacacacataa |
6291250 |
T |
 |
| Q |
101 |
ttggattcttttggactaggttgtctcttcccaacccacgtcaacttccaattatccttttgacctcaataccctttagccactttcttcatacaaaagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6291249 |
ttggattcttttggactaggttgtctctttccaacccacgtcaacttccaattatccttttgacctcaataccctttagccactttcttcatacaaaagc |
6291150 |
T |
 |
| Q |
201 |
aaagaga |
207 |
Q |
| |
|
||||||| |
|
|
| T |
6291149 |
aaagaga |
6291143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University