View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14300_low_27 (Length: 396)
Name: NF14300_low_27
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14300_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 19 - 381
Target Start/End: Complemental strand, 4089734 - 4089372
Alignment:
| Q |
19 |
ttgaattgaaaactattctctatagatcattacgaagtatatactaggttggtagtttggatttttgagtcacttgacctaacaatttcataatagtaca |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4089734 |
ttgaattgaaaactattctttatagatcattacgaagtatatactaggttggtagtttggatttttgagtcaattgacctaacaatttcataatagtaca |
4089635 |
T |
 |
| Q |
119 |
ttatctttcgtgtagggttggttcggaaactattctttattgatcattaagtattgtcatgtcttttatttataagaaaaatattaacaaagtttggtgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4089634 |
ttatctttcgtgtagggttggttcggaaactattctttattgatcattaagtattgtcatgtcttttatttataagaaaaatattaacaaagtttggtag |
4089535 |
T |
 |
| Q |
219 |
agaaaattgtaaaaactatagttgttacaaattttgttaacaataataattcaacacatgtgcagttcttggtgtcggcatctgtattttcgtggtggca |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4089534 |
agaaaattgtaaaaactatagttgttacaaattttgttaacaataataattcaacacatgtgcagttcttggtgtcggcatctgtattttcgtggtggca |
4089435 |
T |
 |
| Q |
319 |
acacttgtaggcataaaggttcatttatcaaggaggaatttccataagaaagaaggacctttg |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4089434 |
acacttgtaggcataaaggttcatttatcaaggaggaatttccataagaaagaaggacctttg |
4089372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University