View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14300_low_41 (Length: 260)
Name: NF14300_low_41
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14300_low_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 32 - 235
Target Start/End: Original strand, 9728441 - 9728644
Alignment:
| Q |
32 |
attattctccttgttctacctgaagatataaagcgttgagtagcatttgcaagataacgagaatttttggttgaagagaagataattgagaattttggaa |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9728441 |
attattctccttgttctacctgaagatataaagcgttgagtagcatttgcaagataacgagaatttttggttgaagagaagataattgagaattttggaa |
9728540 |
T |
 |
| Q |
132 |
gcgatctaagcatgatgttgttattgttaatgtgaaacaaagtattgaagttgaaggttgaaaaattgaatgaatgaggttggaattgtatttatttgaa |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9728541 |
gcgatctaagcatgatgttgttattgttaatgtgaaacaaagtattgaagttgaaggttgaaaaattgaatgaatgaggttggaattgtatttatttgat |
9728640 |
T |
 |
| Q |
232 |
tggg |
235 |
Q |
| |
|
|||| |
|
|
| T |
9728641 |
tggg |
9728644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University