View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14300_low_46 (Length: 244)
Name: NF14300_low_46
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14300_low_46 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 188
Target Start/End: Complemental strand, 32815597 - 32815424
Alignment:
| Q |
15 |
cataggcataatctatagtatcaattgtgccacaaaataacaacttaaaccacgtatttttatgacaagttagttaaccacactagataacttaaactac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32815597 |
cataggcataatctatagtatcaattgtgccacaaaataacaacttaaaccacgtatttttatgacaagttagttaaccacactagatcacttaaactac |
32815498 |
T |
 |
| Q |
115 |
gaaatgtattttttaaagtgaatgatgacggtaacctttatgaccaatatatgatattatgaattgcaaagtat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32815497 |
gaaatgtattttttaaagtgaatgatgacggtaacctttatgaccaatatatgatattatgaattgcaaagtat |
32815424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University