View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14300_low_47 (Length: 243)
Name: NF14300_low_47
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14300_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 8 - 227
Target Start/End: Original strand, 11830518 - 11830735
Alignment:
| Q |
8 |
cgactttactgtcgaaaacaaacacttgaaaactcatgctaacagtgtcgcaatttgtgttgcgagtttcgagtcacgttgttatgggttcggttccgac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| | || |||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
11830518 |
cgactttactgtcgaaaacaaacacttgaaaactcatgctaacagtgttgcaatctatgctgcgagtttcgagtcacgctgttatgggttcagttccgac |
11830617 |
T |
|
| Q |
108 |
aagtacctttctctgtagtgtttgcgagcatccaatcttcagtcaaatgatgtgttctctccatcacatgtgtgcagagttctgttacatcttgcaagga |
207 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||| |||||||||| |||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
11830618 |
aagtacctttctc--tagtgttagcgagcatccaatcttccgtcaaatgatatgttctctccatcagatatgtgcagagttctgttacatcttgcaagga |
11830715 |
T |
|
| Q |
208 |
ttttaaattgtagtgtttca |
227 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
11830716 |
ttttaaattgtagtgtttca |
11830735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University