View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14300_low_49 (Length: 237)
Name: NF14300_low_49
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14300_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 18 - 226
Target Start/End: Complemental strand, 1587477 - 1587269
Alignment:
| Q |
18 |
cacaattttccactaaaaaatcatcttttcattttcattctctctccgccgtctcctccgccgcactccgtcgtctccgccatcgtttccgtttaatcct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1587477 |
cacaattttccactaaaaaatcatcttttcattttcattctctctccgccgtctcctccgccgcactccgtcgtctccgccatcgttcccgtttaatcct |
1587378 |
T |
|
| Q |
118 |
ccttctttccctcccnnnnnnnnnnnncttactatccccacctactcactctttcttctttaatttcctatctgctttcgctttctccgccgcacttttc |
217 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1587377 |
ccttctttccctcccttttttctttttcttactatccccacctactcactctttcttctttaatttcctatctgctttcgctttctccgccgcacttttc |
1587278 |
T |
|
| Q |
218 |
ttctctctc |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
1587277 |
ttctctctc |
1587269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University