View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14300_low_51 (Length: 230)
Name: NF14300_low_51
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14300_low_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 17 - 213
Target Start/End: Complemental strand, 21259124 - 21258929
Alignment:
| Q |
17 |
aatatattgcac-acataaagttctagactttttgaaagaacataaaaagttctagactgatatagggtttgtgtacggaattgtcattattttgttttg |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21259124 |
aatatattgcactacataaagttctagactttttgaaagaacataaa--gttctagacttatatagggtttgtgtacggaattgtcattattttgttttg |
21259027 |
T |
 |
| Q |
116 |
aagggattatgattctcggtgaaccagaaaatttcctattaatttatacccaacaagatatgcattaattcttttaatggaaaaaattaataattatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
21259026 |
aagggattatgattctcggtgaaccataaaatttcctattaatttatacccaacaagatatgcattaatttttttaatagaaaaaattaataattatt |
21258929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University