View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14300_low_53 (Length: 222)
Name: NF14300_low_53
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14300_low_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 33986208 - 33986421
Alignment:
| Q |
1 |
gaattttgaatggatttatggatattgttttgttccatccattactctaggtattaggtatat------gagttacatatatcttatatattcgtcatat |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33986208 |
gaattttgaatggatttatggatattgttttgttccatccattactctaggtattaggtatatgaatatgagttacatatatcttatatattcgtcatat |
33986307 |
T |
 |
| Q |
95 |
aaaagttggaaatcacatatagatgtagtgttgatcatttccgttaatatcatagatgagatgtgaatacctaattgctaaatatgaatgttggtttgag |
194 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33986308 |
aaaagttggaaatcacatatacatgtagtgttgatcatttccgttaatatcatagatgagatgtgaatacctaattgctaaatatgaatgttggtttgag |
33986407 |
T |
 |
| Q |
195 |
tataggagttgctg |
208 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33986408 |
tataggagttgctg |
33986421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University