View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14300_low_54 (Length: 218)
Name: NF14300_low_54
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14300_low_54 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 19 - 201
Target Start/End: Original strand, 29479619 - 29479796
Alignment:
| Q |
19 |
atataataaatcgtaaattgtaaaataatctcttagaatatcaaatcaacaccaaacataatactccctaatnnnnnnnnttacggagtctggttcactc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
29479619 |
atataataaatcgtaaattgtaaaataatctcttaaaatatcaa-----caccaaacataatactccctaataaaaaaaattacggaatctggttcactc |
29479713 |
T |
 |
| Q |
119 |
tcttaaaaacgatggaagagttctctctttctctctaatttcttccaaaaagcactctcaattgtgggttcatgatggaagtt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
29479714 |
tcttaaaaacgatggaagagttctctctttctctctaatttcttccaaaaagcactctcatttgtcggttcatgatggaagtt |
29479796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University