View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14300_low_57 (Length: 213)
Name: NF14300_low_57
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14300_low_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 12 - 195
Target Start/End: Original strand, 36273191 - 36273376
Alignment:
| Q |
12 |
gagagagatgaattactcacgtgtgattaatttagatgtgataggaagggaacatgataaagaaaagatcataaagcatttgattcaacatgataattat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36273191 |
gagagagatgaattactcacgtgtgattaattcagatgtgataggaagggaacatgataaagaaaagatcataaagcatttgattcaacatgataattat |
36273290 |
T |
 |
| Q |
112 |
caaaa--tttctgttgtccctattgtggggtttcggggcgtgggaaagactacacttgcaaagcttgtgttcaataatgagagaat |
195 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36273291 |
caaaatctctctgttgtccctattgtggggtttcggagcgtgggaaagactacacttgcaaagcttgtgttcaatgatgagagaat |
36273376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 83
Target Start/End: Original strand, 49351816 - 49351866
Alignment:
| Q |
33 |
tgtgattaatttagatgtgataggaagggaacatgataaagaaaagatcat |
83 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
49351816 |
tgtgattgattctgatgtgataggaagggaacatgataaacaaaaaatcat |
49351866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University