View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14302_high_2 (Length: 300)
Name: NF14302_high_2
Description: NF14302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14302_high_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 23 - 182
Target Start/End: Complemental strand, 4342156 - 4341997
Alignment:
| Q |
23 |
aaaaatatgattatataggcgataaagtttttgattaagggttataaatgttacagtatttatggggttttgactgaaaaactttagattaagatcattt |
122 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||| || |||| ||||| |||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4342156 |
aaaaatatgatcatatagacgataaagtttttgatcaaaggttttaaatattactgtatttatggggttttgaccgaaaaactttagattaagatcattt |
4342057 |
T |
|
| Q |
123 |
atatttgttattgatttaaaaagaaagatatatatgccatctcatttgatcagttctaga |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4342056 |
atatttgttattgatttaaaaagaaagatatatatgccatctcatttgatcagttctaga |
4341997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 213 - 285
Target Start/End: Complemental strand, 4341963 - 4341891
Alignment:
| Q |
213 |
ctctaaagaatgacaattattcatgtattcatgcaaaaatacttaagtttcatttagatttgcatacctttgt |
285 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4341963 |
ctctaaagaacgacaattattcacgtgttcatgcaaaaatacttaagtttcatttagatttgcatacctttgt |
4341891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University