View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14303_high_5 (Length: 334)
Name: NF14303_high_5
Description: NF14303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14303_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 4e-66; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 54 - 279
Target Start/End: Complemental strand, 32365113 - 32364880
Alignment:
| Q |
54 |
gacagtttcttgttcacttgtttatccagcttgctgatcttgcctacttcacatgggtatgtatgtcttcatcaactacttttgaattttgttatatcac |
153 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32365113 |
gacattttcttgttcacttgtttatccagcttgctgatcttgcctgcttcacatgggtatgtatgtcttcatcaactacttttgaa-tttgttatatcaa |
32365015 |
T |
|
| Q |
154 |
ttcatccttttgtgagtgatttcataaatttcagttgctcaattcac---------tttgannnnnnnnnaaacaattcactttgatgttgttattgttt |
244 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
32365014 |
ttcatccttttgtgagtgatttcacaaattttagttgctcaattcacttttttttttttttttttttgtcaaacaattcactttgatgttgttattgttt |
32364915 |
T |
|
| Q |
245 |
tataataaatcctcttatcaaatgtttttcctatt |
279 |
Q |
| |
|
||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
32364914 |
tataaaaaatcctcttttcaaatgttcttcctatt |
32364880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 14 - 279
Target Start/End: Original strand, 32314964 - 32315239
Alignment:
| Q |
14 |
actctcttcaaatgatatattttgtgtcttatgcatggtggacagtttcttgttcacttgtttatccagcttgctgatcttgcctacttca------cat |
107 |
Q |
| |
|
|||||||||||||||||||||||||| | || | || |||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32314964 |
actctcttcaaatgatatattttgtgccctaag----gttgacagtttctagttcacttgtttatccagcttgctgatcttgcctacttcaaaatcacat |
32315059 |
T |
|
| Q |
108 |
gggtatgtatgtcttcatcaactacttttgaattttgttatatcacttcatccttttgtgagtgatttcataaatttcagttgctcaattcactttga-- |
205 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||| | |||||||||||||||||||||||| |||||| || |||||||||||||||| |
|
|
| T |
32315060 |
gggtatgtatgtcttcatcaactgcttttgggttttgttatagtaattcatccttttgtgagtgatttcacaaattttagcagctcaattcactttgatt |
32315159 |
T |
|
| Q |
206 |
------nnnnnnnnnaaacaattcactttgatgttgttattgttttataataaatcctcttatcaaatgtttttcctatt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
32315160 |
ttttattttttttacaaacaattcactttgatgttgttattgttttataataaatcctcttttcaaatgttcttcctatt |
32315239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 226 - 279
Target Start/End: Complemental strand, 32308802 - 32308749
Alignment:
| Q |
226 |
tttgatgttgttattgttttataataaatcctcttatcaaatgtttttcctatt |
279 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32308802 |
tttgattttgttattgttttataataaatcctcttatcaaatatttttcctatt |
32308749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 102 - 137
Target Start/End: Complemental strand, 32308862 - 32308827
Alignment:
| Q |
102 |
tcacatgggtatgtatgtcttcatcaactacttttg |
137 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32308862 |
tcacatgggtatgtatgtcttcatcaactgcttttg |
32308827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University