View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14303_high_7 (Length: 262)
Name: NF14303_high_7
Description: NF14303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14303_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 247
Target Start/End: Original strand, 20210513 - 20210741
Alignment:
| Q |
19 |
aaatgtgggactttctttccctttctctattcacatacttctatagtgacatcaatatagtggagggccttcttcatatctcttattggctatttagtta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20210513 |
aaatgtgggactttctttccctttctctattcacatacttctatagtgacatcaatatagtggagggccttcttcatatctcttattggctaattagtta |
20210612 |
T |
 |
| Q |
119 |
agtgatgccttcaacaaacagttttgttacctcaagggttctagcatgcaatgtgtttttccctttcctttccctttcttttgtgtgtttggaattgatg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20210613 |
agtgatgccttcaacaaacagttttgttacctcaagggttctagcattcatagtgtttttccctttcctttccctttcttttgtgtgtttggaattgatg |
20210712 |
T |
 |
| Q |
219 |
tagaagggtttgggatgttacttcctttg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20210713 |
tagaagggtttgggatgttacttcctttg |
20210741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University