View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14303_low_13 (Length: 213)

Name: NF14303_low_13
Description: NF14303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14303_low_13
NF14303_low_13
[»] chr3 (1 HSPs)
chr3 (104-198)||(35230689-35230783)


Alignment Details
Target: chr3 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 104 - 198
Target Start/End: Original strand, 35230689 - 35230783
Alignment:
104 atttgatggactaataccagacatggtttcataagactgatctcnnnnnnnnnnnnnnnnnggagacatggttcaaaactaagcatttacacggt 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||                 ||||||||||||||||||||||||||||||||||    
35230689 atttgatggactaataccagacatggtttcataagactgatctctttttagtttttattttggagacatggttcaaaactaagcatttacacggt 35230783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University