View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14304_high_10 (Length: 407)
Name: NF14304_high_10
Description: NF14304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14304_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 8 - 392
Target Start/End: Original strand, 9379152 - 9379537
Alignment:
| Q |
8 |
gtatattattctagaaatagcaacttaattgattggtcaccnnnnnnnctataaagattgatcactttatatcacgtttttcatgctgaataggatgtct |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379152 |
gtatatttttctagaaatagcaacttaattgattggtcacctttttttctataaagattgatcactttatatcacgtttttcatgctgaataggatgtct |
9379251 |
T |
 |
| Q |
108 |
ccaaaattaaacgttagtatttgctaggaataaatcctcaagctttttaacatcccactttt-ttatcaagtcagctctcatttttctctaacatgagaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379252 |
ccaaaattaaacgttagtatttgctaggaataaatcctcaagctttgtaacatcccactttttttatcaagtcagctctcatttttctctaacatgagaa |
9379351 |
T |
 |
| Q |
207 |
ttgtgcacactgcatcctaaaattcacataaatatcttttatatagtttttatttttgaagtagaaatgacaaaaatatttcaaacatatgttcttaatt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9379352 |
ttgtgcacactgcatcctaaaattcacataaatatcttttatatagtttttatttttgaagtagaaatgacaaaaatatttcaaacatatgctcttaatt |
9379451 |
T |
 |
| Q |
307 |
aaacaagttgtaactctgtgacgggtttttgcaggtcccatgtcttttgctgaaaagatggtgttatgtgtatttggggtatgtct |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9379452 |
aaacaagttgtaactctgtgacgggtttttgcaggtcccatgtcttttgctgaaaagatggtgttatgtgtatttggggtatgtct |
9379537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University