View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14304_high_15 (Length: 344)
Name: NF14304_high_15
Description: NF14304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14304_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 47051839 - 47051566
Alignment:
| Q |
1 |
gtaagttcatccttatgtgatctcaaggttttatgctgcgatttggtattcaatgatctcaaggtggatgcaaacttgtttttagtagattgcctaagac |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47051839 |
gtaagttcatccttatgtcatctcaaggttttatgctgcgatttggtattcaatgatctcaaggtggatgcaaacttgtttttagtagattgcctaagac |
47051740 |
T |
 |
| Q |
101 |
ttgcttcattagagtgtgaattggataccttaagcattaagactcctatgttaaagagtggtaaattctccatttcacgaaaacaagatcttaaagcatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47051739 |
ttgcttcattagagtgtgaattggataccttaagcattaagactcctatgttaaagagcggtaaattctccatttcacgaaaacaagatcttaaagcatt |
47051640 |
T |
 |
| Q |
201 |
tgttgctctctgtgcaacgtttccatagcttgagattttgcatgtggaaatatttccaatggttagtcagaaga |
274 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47051639 |
tgttgctctctgtgcaacgtttccacaacttgagattttgcatgtggaaatatttccaatggttagtcagaaga |
47051566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University