View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14304_high_27 (Length: 235)
Name: NF14304_high_27
Description: NF14304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14304_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 21 - 123
Target Start/End: Complemental strand, 23037065 - 23036969
Alignment:
| Q |
21 |
tgtggagtgcatctaatatcaacatcaaaatattagtttaaaggtagacttacacttaccttttaatttaaatagaacattatactttacctctttcttc |
120 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23037065 |
tgtggagtgcatctaatatcaacttcaaaatattagtgtaaaggtagacttac------cttttaatttaaatagaacattatactttatctctttcttc |
23036972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 221
Target Start/End: Complemental strand, 23036590 - 23036555
Alignment:
| Q |
186 |
gggttcatattaaaatacgttttttgtgacattttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
23036590 |
gggttcatattaaaatacgttttttgtgacattttt |
23036555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University