View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14304_low_18 (Length: 290)
Name: NF14304_low_18
Description: NF14304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14304_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 15 - 259
Target Start/End: Original strand, 31480196 - 31480439
Alignment:
| Q |
15 |
atcggtttggtttttaagaaaacataaattcaaacaaataaaaataattgatttgatttggttaggtttggtttttgcaatcttttctcgcaaaatcaaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31480196 |
atcggtttggtttttaagaaaacataaattcaaacaaataaaa-taattgatttgatttgattaggtttggtttttgcaatcttttctcgcaaaatcaaa |
31480294 |
T |
 |
| Q |
115 |
accaatgaaaatgaggcattgattaattagttttgttcaatcgggttgacgtgtttaaaaattttagaaacattatctaaaaagtctaagaaaattaact |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31480295 |
accaatgaaaatgaggcattgatttattagtttggttcaatcgggttgacatgtttaaaaattttagaaacattatctaaaaagtctaagaaaattaact |
31480394 |
T |
 |
| Q |
215 |
tttaagaaacttttatactattaaaacaagtatataaactgcaat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31480395 |
tttaagaaacttttatactattaaaacaagtatataaactgcaat |
31480439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University