View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14304_low_20 (Length: 271)
Name: NF14304_low_20
Description: NF14304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14304_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 251
Target Start/End: Original strand, 53453592 - 53453826
Alignment:
| Q |
17 |
atcaatgatttcgcaaaactcaacgacatcaaaatcgtgtgcattgattcatcaccggaggaagatgaacatgttgtgaacttttctgctttaacaaatg |
116 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||||| ||||||||||| |
|
|
| T |
53453592 |
atcaacgatttcgcaaaactcatcgacatcaaaatcgtgtgcattgattcatcaccggaggaagatgaaaatgttgtggatttttctgttttaacaaatg |
53453691 |
T |
 |
| Q |
117 |
ctgatgaaaacgaattaccagaagttaaaataaacccaaacgacgtggttgcgttaccgttttcttcaggaacttctggtttaccaaaaggtgttatgtt |
216 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53453692 |
ctgatgaaaacgaattaccagaagtaaaaataaacccaaacgatgtagttgcgttaccgttttcttcaggaacttctggtttaccaaaaggtgttatgtt |
53453791 |
T |
 |
| Q |
217 |
aacacatgaaaatttagttacaacaatatcacagt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
53453792 |
aacacatgaaaatttagttacaacaatatcacagt |
53453826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University