View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14304_low_23 (Length: 262)
Name: NF14304_low_23
Description: NF14304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14304_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 47416954 - 47417202
Alignment:
| Q |
1 |
aatgaagagaggcaggttggctatactacttgccaaggcgaaaaacaaaggaaaatgttcatgcttcactgaaagatttgaagaacataaatctgattct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47416954 |
aatgaagagaggcaggttggctatactacttgccaaggcgaaaaacaaaggaaaatgttcatgcttcactgaaagatttgaagaacataaatctgattct |
47417053 |
T |
|
| Q |
101 |
ccacctgtcccccaggaaaagaagagcaaaaaggacattgttattggtacctggcgagatatttttgctgttgaaaatttttcctttttatatgaaatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47417054 |
ccacctgtcccccaggaaaagaagagcaaaaaggacattgttattggtacctggcgagatatttttgctgttgaaaaattttcctttttatatgaaatat |
47417153 |
T |
|
| Q |
201 |
gattttggttacacgccaataaattttccttttcctagcgcataaaact |
249 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47417154 |
gattttggttacacaccaataaattttccttttcctagcgcataaaact |
47417202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University