View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14305_low_10 (Length: 239)
Name: NF14305_low_10
Description: NF14305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14305_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 3846085 - 3845862
Alignment:
| Q |
1 |
tttcacattgatttacccccaaaaatattgatttacaatatggatgaaccattgtagtaatttggttggggaaagaaacaacaagatcgat--gggnnnn |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || || |
|
|
| T |
3846085 |
tttcacattgatttacccccaaaaatattgatttacaatatggatgaaccattgtagtaatt-ggttggggaaagaaacaacaagatcaataaggaaaaa |
3845987 |
T |
|
| Q |
99 |
nnnntatcaaaacaaaattacaaggttaattgagaaacaatctatctagctaataaaactaataatctaattaatattatttaagttggtttcttgaaaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3845986 |
aaaatatcaaaacaaaattacaaggttaattgagaaacaatctatctagctaataaaactaataatctaattaatattatttaagttggtttcttgaaaa |
3845887 |
T |
|
| Q |
199 |
tattttttgtccaggtgcaagaata |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3845886 |
tattttttgtccaggtgcaagaata |
3845862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University