View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14305_low_12 (Length: 229)
Name: NF14305_low_12
Description: NF14305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14305_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 15 - 212
Target Start/End: Original strand, 3744073 - 3744270
Alignment:
| Q |
15 |
cagagaagatttttggaatatggaacagagaagctttgcacaagagaaagcatatggcatagatagaaacagtgacacatcattcgggataaaacgctat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3744073 |
cagagaagatttttggaatatggaacagagaagctttgcacaagagaaagcatatggcatagattgaaacagtgacacatcattcgggataaaacgctat |
3744172 |
T |
|
| Q |
115 |
gtttagcattattgaaacatagcaaaaacgttttatcccgtagcatcccaaatgatgtatcactgtccctatatctatgtcatgtgctttctcttgtg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
3744173 |
gtttagcattattgaaacatagcaaaaacgttttatcccgtagcatcccaaatgatgtatcactgttcctatatctatgccatgtgctttctcttgtg |
3744270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 104
Target Start/End: Complemental strand, 3744278 - 3744217
Alignment:
| Q |
45 |
aagctttgcacaagagaaagcatatggcatag--atagaaacagtgacacatcattcgggat |
104 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| |||| |||||||| |||||||| ||||| |
|
|
| T |
3744278 |
aagctttacacaagagaaagcacatggcatagatataggaacagtgatacatcatttgggat |
3744217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 37 - 80
Target Start/End: Original strand, 20196243 - 20196286
Alignment:
| Q |
37 |
gaacagagaagctttgcacaagagaaagcatatggcatagatag |
80 |
Q |
| |
|
||||| ||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
20196243 |
gaacaaagaagttttgcacaagagaaagcatgtggcatagatag |
20196286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University