View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14306_high_4 (Length: 264)
Name: NF14306_high_4
Description: NF14306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14306_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 32328694 - 32328449
Alignment:
| Q |
1 |
agacccaccaaatttcataacaacactgtaactcttttcagtttcctctaccttctcagccccaaaatcactttccctcgcattgttgctgcagcaactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32328694 |
agacccaccaaatttcataacaacactgtaactcttttcagtttcctctaacttctcagccccaaaatcactttccctcgcattgttgctgcagcaactg |
32328595 |
T |
 |
| Q |
101 |
attctaactgaatcactcgacactttcttcacaagcggaacgtgggaaacacgcgctgtgtacccgattcgacacggcaacaaagatgattggcagtgtg |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32328594 |
attctaactgcatcactcgacactttcttcacaagcggaacgtgggaaacacgcgctgtgtacccgattcgacacggcaacaaagatgattggcaatgtg |
32328495 |
T |
 |
| Q |
201 |
agattttgcgcgtagttgctactgggaatacgcttttaacgtaacc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32328494 |
agattttgcgcgtagttgctactgggaatacgcttttaacgtaacc |
32328449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University