View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14306_low_5 (Length: 374)
Name: NF14306_low_5
Description: NF14306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14306_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 156 - 357
Target Start/End: Original strand, 35036911 - 35037112
Alignment:
| Q |
156 |
gattcatagtgaacattgcccaaatatgcacagctatagtcgatgcagaaatgcctgcaagcgcaaggtacatgcacttatcccacttaacaaggaattc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35036911 |
gattcatagtgaacattgcccaaatatgcacagctatagtcgatgcagaaatgcctgcaagcgcaaggtacatgcacttatcccacttaactaggaattc |
35037010 |
T |
 |
| Q |
256 |
caatgaatcgcaagattgtgcactcaaatctttcggtctatctaaagcatgcattgttttcctcccttcaacttcacgtggaaacattagtttcacagtg |
355 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35037011 |
caatgaatcgcaaaattgtgcactcaaatctttcggtctatctaaagcatgcattgtttttctcccttcaacttcacgtggaaacattagtttcacagtg |
35037110 |
T |
 |
| Q |
356 |
tt |
357 |
Q |
| |
|
|| |
|
|
| T |
35037111 |
tt |
35037112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University